Review



grna sequences  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Addgene inc grna sequences
    Grna Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/grna sequences/product/Addgene inc
    Average 93 stars, based on 10 article reviews
    grna sequences - by Bioz Stars, 2026-05
    93/100 stars

    Images



    Similar Products

    96
    Broad Clinical Labs sgrna online web page
    Sgrna Online Web Page, supplied by Broad Clinical Labs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sgrna online web page/product/Broad Clinical Labs
    Average 96 stars, based on 1 article reviews
    sgrna online web page - by Bioz Stars, 2026-05
    96/100 stars
      Buy from Supplier

    93
    Addgene inc grna sequences
    Grna Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/grna sequences/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    grna sequences - by Bioz Stars, 2026-05
    93/100 stars
      Buy from Supplier

    90
    Addgene inc human pooled genome wide sgrna library brunello sequences addgene addgene
    Human Pooled Genome Wide Sgrna Library Brunello Sequences Addgene Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/human pooled genome wide sgrna library brunello sequences addgene addgene/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    human pooled genome wide sgrna library brunello sequences addgene addgene - by Bioz Stars, 2026-05
    90/100 stars
      Buy from Supplier

    95
    Addgene inc ephx2 sgrna sequences
    A and B , Immunofluorescence imaging and quantification of P14 isolated cardiomyocytes ( A ) and E13.5 mouse embryonic fibroblasts ( B ). C , Western blot images and quantification of nuclear/cytoplasmic <t>EPHX2</t> in Lmna Δ/Δ mouse hearts. D , Quantification by qRT-PCR and western blot images of Lmna Δ/Δ hearts. E , Immunofluorescence images and quantification of EPHX2 in isolated cardiomyocytes of P14 CKO mice. F , Immunofluorescence images and quantification of NE rupture and EPHX2 location. P values were generated by Mann-Whitney U test. * P <0.05, ** P <0.01, *** P <0.001, mean ± SD. FC, fold change. n represents numbers of cells ( A , B , E and F ) or mice ( C and D ). LB1, lamin-B1. HA, hemagglutinin. LSL, loxP-stop-loxP. NE, nuclear envelop.
    Ephx2 Sgrna Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ephx2 sgrna sequences/product/Addgene inc
    Average 95 stars, based on 1 article reviews
    ephx2 sgrna sequences - by Bioz Stars, 2026-05
    95/100 stars
      Buy from Supplier

    95
    Addgene inc plasmid sequence
    A and B , Immunofluorescence imaging and quantification of P14 isolated cardiomyocytes ( A ) and E13.5 mouse embryonic fibroblasts ( B ). C , Western blot images and quantification of nuclear/cytoplasmic <t>EPHX2</t> in Lmna Δ/Δ mouse hearts. D , Quantification by qRT-PCR and western blot images of Lmna Δ/Δ hearts. E , Immunofluorescence images and quantification of EPHX2 in isolated cardiomyocytes of P14 CKO mice. F , Immunofluorescence images and quantification of NE rupture and EPHX2 location. P values were generated by Mann-Whitney U test. * P <0.05, ** P <0.01, *** P <0.001, mean ± SD. FC, fold change. n represents numbers of cells ( A , B , E and F ) or mice ( C and D ). LB1, lamin-B1. HA, hemagglutinin. LSL, loxP-stop-loxP. NE, nuclear envelop.
    Plasmid Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plasmid sequence/product/Addgene inc
    Average 95 stars, based on 1 article reviews
    plasmid sequence - by Bioz Stars, 2026-05
    95/100 stars
      Buy from Supplier

    96
    DSMZ acc 554 oligonucleotides sgrna sequence
    A and B , Immunofluorescence imaging and quantification of P14 isolated cardiomyocytes ( A ) and E13.5 mouse embryonic fibroblasts ( B ). C , Western blot images and quantification of nuclear/cytoplasmic <t>EPHX2</t> in Lmna Δ/Δ mouse hearts. D , Quantification by qRT-PCR and western blot images of Lmna Δ/Δ hearts. E , Immunofluorescence images and quantification of EPHX2 in isolated cardiomyocytes of P14 CKO mice. F , Immunofluorescence images and quantification of NE rupture and EPHX2 location. P values were generated by Mann-Whitney U test. * P <0.05, ** P <0.01, *** P <0.001, mean ± SD. FC, fold change. n represents numbers of cells ( A , B , E and F ) or mice ( C and D ). LB1, lamin-B1. HA, hemagglutinin. LSL, loxP-stop-loxP. NE, nuclear envelop.
    Acc 554 Oligonucleotides Sgrna Sequence, supplied by DSMZ, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/acc 554 oligonucleotides sgrna sequence/product/DSMZ
    Average 96 stars, based on 1 article reviews
    acc 554 oligonucleotides sgrna sequence - by Bioz Stars, 2026-05
    96/100 stars
      Buy from Supplier

    93
    Cyagen Biosciences tctctccctagtagctcgac tgg cyagen n a human tfeb sgrna targeting sequence
    A and B , Immunofluorescence imaging and quantification of P14 isolated cardiomyocytes ( A ) and E13.5 mouse embryonic fibroblasts ( B ). C , Western blot images and quantification of nuclear/cytoplasmic <t>EPHX2</t> in Lmna Δ/Δ mouse hearts. D , Quantification by qRT-PCR and western blot images of Lmna Δ/Δ hearts. E , Immunofluorescence images and quantification of EPHX2 in isolated cardiomyocytes of P14 CKO mice. F , Immunofluorescence images and quantification of NE rupture and EPHX2 location. P values were generated by Mann-Whitney U test. * P <0.05, ** P <0.01, *** P <0.001, mean ± SD. FC, fold change. n represents numbers of cells ( A , B , E and F ) or mice ( C and D ). LB1, lamin-B1. HA, hemagglutinin. LSL, loxP-stop-loxP. NE, nuclear envelop.
    Tctctccctagtagctcgac Tgg Cyagen N A Human Tfeb Sgrna Targeting Sequence, supplied by Cyagen Biosciences, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tctctccctagtagctcgac tgg cyagen n a human tfeb sgrna targeting sequence/product/Cyagen Biosciences
    Average 93 stars, based on 1 article reviews
    tctctccctagtagctcgac tgg cyagen n a human tfeb sgrna targeting sequence - by Bioz Stars, 2026-05
    93/100 stars
      Buy from Supplier

    96
    Addgene inc sgrna sequence to px330
    A and B , Immunofluorescence imaging and quantification of P14 isolated cardiomyocytes ( A ) and E13.5 mouse embryonic fibroblasts ( B ). C , Western blot images and quantification of nuclear/cytoplasmic <t>EPHX2</t> in Lmna Δ/Δ mouse hearts. D , Quantification by qRT-PCR and western blot images of Lmna Δ/Δ hearts. E , Immunofluorescence images and quantification of EPHX2 in isolated cardiomyocytes of P14 CKO mice. F , Immunofluorescence images and quantification of NE rupture and EPHX2 location. P values were generated by Mann-Whitney U test. * P <0.05, ** P <0.01, *** P <0.001, mean ± SD. FC, fold change. n represents numbers of cells ( A , B , E and F ) or mice ( C and D ). LB1, lamin-B1. HA, hemagglutinin. LSL, loxP-stop-loxP. NE, nuclear envelop.
    Sgrna Sequence To Px330, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sgrna sequence to px330/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    sgrna sequence to px330 - by Bioz Stars, 2026-05
    96/100 stars
      Buy from Supplier

    94
    Addgene inc sgrna targeting gfp sequence
    A and B , Immunofluorescence imaging and quantification of P14 isolated cardiomyocytes ( A ) and E13.5 mouse embryonic fibroblasts ( B ). C , Western blot images and quantification of nuclear/cytoplasmic <t>EPHX2</t> in Lmna Δ/Δ mouse hearts. D , Quantification by qRT-PCR and western blot images of Lmna Δ/Δ hearts. E , Immunofluorescence images and quantification of EPHX2 in isolated cardiomyocytes of P14 CKO mice. F , Immunofluorescence images and quantification of NE rupture and EPHX2 location. P values were generated by Mann-Whitney U test. * P <0.05, ** P <0.01, *** P <0.001, mean ± SD. FC, fold change. n represents numbers of cells ( A , B , E and F ) or mice ( C and D ). LB1, lamin-B1. HA, hemagglutinin. LSL, loxP-stop-loxP. NE, nuclear envelop.
    Sgrna Targeting Gfp Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sgrna targeting gfp sequence/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    sgrna targeting gfp sequence - by Bioz Stars, 2026-05
    94/100 stars
      Buy from Supplier

    Image Search Results


    A and B , Immunofluorescence imaging and quantification of P14 isolated cardiomyocytes ( A ) and E13.5 mouse embryonic fibroblasts ( B ). C , Western blot images and quantification of nuclear/cytoplasmic EPHX2 in Lmna Δ/Δ mouse hearts. D , Quantification by qRT-PCR and western blot images of Lmna Δ/Δ hearts. E , Immunofluorescence images and quantification of EPHX2 in isolated cardiomyocytes of P14 CKO mice. F , Immunofluorescence images and quantification of NE rupture and EPHX2 location. P values were generated by Mann-Whitney U test. * P <0.05, ** P <0.01, *** P <0.001, mean ± SD. FC, fold change. n represents numbers of cells ( A , B , E and F ) or mice ( C and D ). LB1, lamin-B1. HA, hemagglutinin. LSL, loxP-stop-loxP. NE, nuclear envelop.

    Journal: bioRxiv

    Article Title: Lmna deficiency promotes EPHX2 nuclear translocation to ameliorate cardiac dysfunction in mice

    doi: 10.64898/2026.02.09.704693

    Figure Lengend Snippet: A and B , Immunofluorescence imaging and quantification of P14 isolated cardiomyocytes ( A ) and E13.5 mouse embryonic fibroblasts ( B ). C , Western blot images and quantification of nuclear/cytoplasmic EPHX2 in Lmna Δ/Δ mouse hearts. D , Quantification by qRT-PCR and western blot images of Lmna Δ/Δ hearts. E , Immunofluorescence images and quantification of EPHX2 in isolated cardiomyocytes of P14 CKO mice. F , Immunofluorescence images and quantification of NE rupture and EPHX2 location. P values were generated by Mann-Whitney U test. * P <0.05, ** P <0.01, *** P <0.001, mean ± SD. FC, fold change. n represents numbers of cells ( A , B , E and F ) or mice ( C and D ). LB1, lamin-B1. HA, hemagglutinin. LSL, loxP-stop-loxP. NE, nuclear envelop.

    Article Snippet: Ephx2 sgRNA sequences were subcloned to AAV-U6-sgRNA-Scaffold- Tnnt2 -SaCas9-HA-OLLAS (Addgene #209781)[ ] to generate the AAV-U6-sgRNA- Tnnt2 -Sacas9-HA vectors.

    Techniques: Immunofluorescence, Imaging, Isolation, Western Blot, Quantitative RT-PCR, Generated, MANN-WHITNEY

    A , Diagram of AAV vectors and the workflow of knocking out Ephx2 . AAV was injected subcutaneously. B , Editing efficiency of Ephx2 by amplicon sequencing analysis in hearts. C , Western blot analysis and quantification of AAV-treated cardiac tissues. D , Echocardiography of cardiac function and dimensions at 2 or 3 weeks after AAV treatment. E , Survival curve with the log-rank test between the CKO and CKO+AAV groups, * P <0.05. F , EET quantification of cardiac tissues by enzyme linked immunosorbent assay (ELISA) and mass-spectrometry analysis. P values were generated by Mann-Whitney U test. * P <0.05, ** P <0.01, *** P <0.001, mean ± SD. n represents numbers of mice. FS, fraction shortening. LVIDd, left ventricular internal dimension in diastole. LVIDs, left ventricular internal dimension in systole. EET, epoxyeicosatrienoic acid.

    Journal: bioRxiv

    Article Title: Lmna deficiency promotes EPHX2 nuclear translocation to ameliorate cardiac dysfunction in mice

    doi: 10.64898/2026.02.09.704693

    Figure Lengend Snippet: A , Diagram of AAV vectors and the workflow of knocking out Ephx2 . AAV was injected subcutaneously. B , Editing efficiency of Ephx2 by amplicon sequencing analysis in hearts. C , Western blot analysis and quantification of AAV-treated cardiac tissues. D , Echocardiography of cardiac function and dimensions at 2 or 3 weeks after AAV treatment. E , Survival curve with the log-rank test between the CKO and CKO+AAV groups, * P <0.05. F , EET quantification of cardiac tissues by enzyme linked immunosorbent assay (ELISA) and mass-spectrometry analysis. P values were generated by Mann-Whitney U test. * P <0.05, ** P <0.01, *** P <0.001, mean ± SD. n represents numbers of mice. FS, fraction shortening. LVIDd, left ventricular internal dimension in diastole. LVIDs, left ventricular internal dimension in systole. EET, epoxyeicosatrienoic acid.

    Article Snippet: Ephx2 sgRNA sequences were subcloned to AAV-U6-sgRNA-Scaffold- Tnnt2 -SaCas9-HA-OLLAS (Addgene #209781)[ ] to generate the AAV-U6-sgRNA- Tnnt2 -Sacas9-HA vectors.

    Techniques: Injection, Amplification, Sequencing, Western Blot, Enzyme-linked Immunosorbent Assay, Mass Spectrometry, Generated, MANN-WHITNEY

    A , Diagram of AAV vectors and the workflow of overexpressing nuclear EPHX2. AAV was injected subcutaneously at P1. B , Western blot analysis of EPHX2 overexpression. C , Immunofluorescence images show the expression and localization of EPHX2 in the myocardium of P14 mouse hearts. The yellow arrow points to the nucleus. D , Echocardiography of cardiac function and structure. E , Total DHET/EET in hearts by ultra performance liquid chromatography-tandem mass spectrometry (UPLC–MS/MS)-based lipidomic. 6 animals per group. The Kruskal-Wallis H test was used. ns, not significant. F , Schematic diagram of inactivating mutation sites in EPHX2 hydrolase. G , Work Flow for the detection of EPHX2 hydrolase activity. H , Dynamic curve of EPHX2 hydrolysis product concentration. I , Schematic diagram of AAV vectors and experimental workflow (left). Echocardiographic analysis of cardiac function in CKO mice (right). CKO mice were injected with 2×10 11 AAV9 to specifically overexpress hydrolase-deficient EPHX2 in cardiomyocyte nuclei at P1. Echocardiographic analysis was performed at P14. P values were generated by Mann-Whitney U test. * P <0.05, *** P <0.001, mean ± SD. n represents numbers of mice. HA, hemagglutinin. NLS, nuclear localization sequence. NES, nuclear export sequence. t-AUCB, trans-4-(4-[3-Adamantan-1-yl-ureido]-cyclohexyloxy)-benzoic acid, a small-molecule inhibitor of EPHX2 hydrolase activity. FS, fraction shortening. LVIDd, left ventricular internal dimension in diastole. LVIDs, left ventricular internal dimension in systole.

    Journal: bioRxiv

    Article Title: Lmna deficiency promotes EPHX2 nuclear translocation to ameliorate cardiac dysfunction in mice

    doi: 10.64898/2026.02.09.704693

    Figure Lengend Snippet: A , Diagram of AAV vectors and the workflow of overexpressing nuclear EPHX2. AAV was injected subcutaneously at P1. B , Western blot analysis of EPHX2 overexpression. C , Immunofluorescence images show the expression and localization of EPHX2 in the myocardium of P14 mouse hearts. The yellow arrow points to the nucleus. D , Echocardiography of cardiac function and structure. E , Total DHET/EET in hearts by ultra performance liquid chromatography-tandem mass spectrometry (UPLC–MS/MS)-based lipidomic. 6 animals per group. The Kruskal-Wallis H test was used. ns, not significant. F , Schematic diagram of inactivating mutation sites in EPHX2 hydrolase. G , Work Flow for the detection of EPHX2 hydrolase activity. H , Dynamic curve of EPHX2 hydrolysis product concentration. I , Schematic diagram of AAV vectors and experimental workflow (left). Echocardiographic analysis of cardiac function in CKO mice (right). CKO mice were injected with 2×10 11 AAV9 to specifically overexpress hydrolase-deficient EPHX2 in cardiomyocyte nuclei at P1. Echocardiographic analysis was performed at P14. P values were generated by Mann-Whitney U test. * P <0.05, *** P <0.001, mean ± SD. n represents numbers of mice. HA, hemagglutinin. NLS, nuclear localization sequence. NES, nuclear export sequence. t-AUCB, trans-4-(4-[3-Adamantan-1-yl-ureido]-cyclohexyloxy)-benzoic acid, a small-molecule inhibitor of EPHX2 hydrolase activity. FS, fraction shortening. LVIDd, left ventricular internal dimension in diastole. LVIDs, left ventricular internal dimension in systole.

    Article Snippet: Ephx2 sgRNA sequences were subcloned to AAV-U6-sgRNA-Scaffold- Tnnt2 -SaCas9-HA-OLLAS (Addgene #209781)[ ] to generate the AAV-U6-sgRNA- Tnnt2 -Sacas9-HA vectors.

    Techniques: Injection, Western Blot, Over Expression, Immunofluorescence, Expressing, Liquid Chromatography, Mass Spectrometry, Tandem Mass Spectroscopy, Mutagenesis, Activity Assay, Concentration Assay, Generated, MANN-WHITNEY, Sequencing

    A , Diagram of gene therapy of NLS knock-in via HDR. B , Work flow of the AAV-HDR system. C , Example of targeted cDNA amplicon-sequencing results. The edited genomic regions were analyzed using CRISPResso2 software, and the editing efficiencies of HDR and NHEJ were calculated separately. D , AAV dose-dependent editing efficiency in mouse hearts evaluated by amplicon sequencing. E , Immunofluorescence images and quantification of EPHX2-positive nucleus in myocardium. n=3. F , Western blot images and quantification of nuclear EPHX2. n=3. G , Diagram of AAV-HDR and control AAVs, and outcomes in Lmna F/F ; Rosa CAG-LSL-Cas9-tdGFP mice after treatment. H , Editing efficiency of HDR and NHEJ-mediated gene edting after 4×10 11 AAV treatment by amplicon sequencing. n=4. I , Echocardiogram analysis of AAV-HDR treated hearts. J , Western blot images and quantification of γH2AX in myocardium. P values were generated by Mann-Whitney U test. * P <0.05, ** P < 0.01, *** P < 0.001, mean ± SD. n represents numbers of mice. HDR, homology-directed repair. NHEJ, non-homologous end-joining. HA, homology arm. Cre, Cyclization recombination. LSL, loxP-stop-loxP. NLS, nuclear localization signal. KO, knock-out. KI, knock-in. FS, fraction shortening. LVIDd, left ventricular internal dimension in diastole. LVIDs, left ventricular internal dimension in systole.

    Journal: bioRxiv

    Article Title: Lmna deficiency promotes EPHX2 nuclear translocation to ameliorate cardiac dysfunction in mice

    doi: 10.64898/2026.02.09.704693

    Figure Lengend Snippet: A , Diagram of gene therapy of NLS knock-in via HDR. B , Work flow of the AAV-HDR system. C , Example of targeted cDNA amplicon-sequencing results. The edited genomic regions were analyzed using CRISPResso2 software, and the editing efficiencies of HDR and NHEJ were calculated separately. D , AAV dose-dependent editing efficiency in mouse hearts evaluated by amplicon sequencing. E , Immunofluorescence images and quantification of EPHX2-positive nucleus in myocardium. n=3. F , Western blot images and quantification of nuclear EPHX2. n=3. G , Diagram of AAV-HDR and control AAVs, and outcomes in Lmna F/F ; Rosa CAG-LSL-Cas9-tdGFP mice after treatment. H , Editing efficiency of HDR and NHEJ-mediated gene edting after 4×10 11 AAV treatment by amplicon sequencing. n=4. I , Echocardiogram analysis of AAV-HDR treated hearts. J , Western blot images and quantification of γH2AX in myocardium. P values were generated by Mann-Whitney U test. * P <0.05, ** P < 0.01, *** P < 0.001, mean ± SD. n represents numbers of mice. HDR, homology-directed repair. NHEJ, non-homologous end-joining. HA, homology arm. Cre, Cyclization recombination. LSL, loxP-stop-loxP. NLS, nuclear localization signal. KO, knock-out. KI, knock-in. FS, fraction shortening. LVIDd, left ventricular internal dimension in diastole. LVIDs, left ventricular internal dimension in systole.

    Article Snippet: Ephx2 sgRNA sequences were subcloned to AAV-U6-sgRNA-Scaffold- Tnnt2 -SaCas9-HA-OLLAS (Addgene #209781)[ ] to generate the AAV-U6-sgRNA- Tnnt2 -Sacas9-HA vectors.

    Techniques: Knock-In, Amplification, Sequencing, Software, Immunofluorescence, Western Blot, Control, Generated, MANN-WHITNEY, Non-Homologous End Joining, Knock-Out